Gene detail

Detailed information of scaffold121.g321.t1 in Morbakka virulenta

Genomic Location: scaffold121:1945318...1947474
NR annotation: MCB1080518.1, adenylosuccinate synthase [Chlamydiia bacterium]
Species Morbakka virulenta · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

scaffold121.g321.t1

ATAACTTTAGATGTGGTAAAAAGATAGTTTTTGTTTGAAAGAGTTTATGAATCAATGCCGACTTTAGCAGTTGTTGGTCTTCAGTGGGGAGATGAAGGTAAAGGTAAAATCATTGATCACTTGGCTCAAGATACCGACATTGTTGTTCGAGCTCAAGGGGGACATAATGCTGGACACAGCGTCATTGCTTGCGGAAAAGAATACCACTTTCACTTGATCCCTTCAGGGGTCCTTTATGATCACACACAGTGTTATATTGGGGATGGTACAGTGATTGACCCAAAGTCTCTTCTTAATGAGATCGATCGGTTGGAAGAGGGTGGTATTTTTCTAAAAAATCGTCTTTTTATTTCTCCATATGCTCATGTGCTGTTTCTTTACCATCAATTACTTGATCAGTTTAAAGAGAAAGAAAGAGGTCGGGATGCAATTGGGACAACAGGCTGTGGTATTGGCCCCTGCTATGTTGATGCTATAGGAAGAGAGGGAATTAGAGTTTGCGATCTGATTAACCCTAAGAGTTTCAAAAAAAAATTGATGGATGTCCTCGCAATCAAAAATCGAGAATTTGAAGCCCTTTATCGGCAAGCACCTCTTGATGAGGAAGTTCTCTTTGAGGAGTATTCTGCTTTTGCTGAGAAGCTTAGACCTTATGTACAACCTTTTGGAGAGCGATTAGAGACTGCAATCCAATTAGGGAAAAAAGTATTGTTTGAAGGAGCACAAGGGGCTCTTTTAGATGTGACTTATGGAACTTATCCCTTTGTTACTTCTTCACATACGACTAGTGCAGGTCTTGCCTTAGGTGCTGGAATTGGGCCAAATCGGATTGAGGCTACACTGGGGGTTGTTAAGGCCTATACGACTCGTGTGGGACAGGGCCCTTTCCCGACAGAGTTTTCCGAAGAAGAGTCAAAGAAATTTTTAAGCCCTTTTCAAGCTCGGGAAGTGGGAACGACAACAGGGAGACTTCGTCGGATTGGTTGGTTTGATGCTGTTCTTGTTCGCTATGCCATTCGATTAAGTGGAGTAAAAGCTCTTGCGTTAACAAAGTTAGATGTGCTTAGCTCTTTAGATTCTATTCAAATTTGTGTTGGTTACAAGATCGGGAATCAAGTTTTGCAAATACCACCGGTTGAATTAGAAGCTTTTGAATCTGTTATTCCTGTTTACAAGATATTTGCAGGTTGGAAAGAGCCGATAAATAAAATTAAATCAGAGGATTTCGATCTCATCGATCCAACACTTGTTCCTCATCACCTTGCTCTCATTATGGACGGAAACCGTCGCTGGGCAAAAAAATTTGATTATCCTTTTGAAGTCGGTCATTGGCAAGGTTCTGAGCGGCTAGACTGTATTGTTCGCGCCGCTGCTGAGTTGGGGATTAAAGTAGTGACGACTTATGCCTTTTCTACCGAAAATTGGAGAAGGCCCCAAGAAGAAATTGATATGCTTATGCAAATTTTAGAGGCCTATCTGATTAATAAGCGCGAGCGCTTGGTTAAAGAAGGTGTGAGACTTCATGCTATCGGAGACCTCTCAAAGTTACCTCAAAATATCCTTGATGCTATGCAAGAAACGCTTGAAGCAACAGAAAAGTGTGACAAAATCGATCTCGTTATTGCGATAAATTATGGTGGCAGAGATGAAATTTGTCGAAGTGTAAAGAAGATCGTAGAAATGATGGAGGAGGGAAGTATAAGCAAAGAGAATATTACGCAAGATTTGATTGCTAATCATCTCGATACAGCTCAGTGGCCAGACCCCGACCTCATCATCCGTACCAGTGGCGAGAACCGAATGAGTAATTTTTTGACTTGGCAGGCTGCATATAGTGAAATCTTAGTGACGGATGTATTATGGCCTGAATTTTCAGAAAAAAATCTATTTGAAGCTGTTTTAGAATTTCAAAAGAGAAGTCGTCGATTTGGAGAGTAGTACACGAAAAATGGTGAATAAATGAATGAAACACGTAACTGCGG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B0K8D7	Adenylosuccinate synthetase OS=Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E) OX=340099 GN=purA PE=3 SV=1
B0K5I0	Adenylosuccinate synthetase OS=Thermoanaerobacter sp. (strain X514) OX=399726 GN=purA PE=3 SV=1
Q8R6T8	Adenylosuccinate synthetase OS=Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4) OX=273068 GN=purA PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003484 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01255 all species →	Prenyltransf	Putative undecaprenyl diphosphate synthase	Family	Interproscan
PF00709 all species →	Adenylsucc_synt	Adenylosuccinate synthetase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001114 all species →	Family	Adenylosuccinate synthetase	Interproscan
IPR042111 all species →	Homologous_superfamily	Adenylosuccinate synthetase, domain 3	Interproscan
IPR001441 all species →	Family	Decaprenyl diphosphate synthase-like	Interproscan
IPR018220 all species →	Binding_site	Adenylosuccinate synthase, GTP-binding site	Interproscan
IPR018520 all species →	Conserved_site	Di-trans-poly-cis-decaprenylcistransferase-like, conserved site	Interproscan
IPR042109 all species →	Homologous_superfamily	Adenylosuccinate synthetase, domain 1	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR042110 all species →	Homologous_superfamily	Adenylosuccinate synthetase, domain 2	Interproscan
IPR036424 all species →	Homologous_superfamily	Decaprenyl diphosphate synthase-like superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11846 all species →	ADENYLOSUCCINATE SYNTHETASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0004019 all species →	Molecular Function	adenylosuccinate synthase activity	Interproscan
GO:0006164 all species →	Biological Process	purine nucleotide biosynthetic process	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0044208 all species →	Biological Process	'de novo' AMP biosynthetic process	Interproscan
GO:0046040 all species →	Biological Process	IMP metabolic process	Interproscan
GO:0016765 all species →	Molecular Function	transferase activity, transferring alkyl or aryl (other than methyl) groups	Interproscan
GO:0005525 all species →	Molecular Function	GTP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for scaffold121.g321.t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Morbakka virulenta tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Morbakka virulenta, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →