Gene detail

Detailed information of scaffold121.g348.t1 in Morbakka virulenta

Genomic Location: scaffold121:2157768...2161986
NR annotation: CCB88376.1, UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelateligase [Simkania negevensis Z]
Species Morbakka virulenta · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

scaffold121.g348.t1

GGGACTGAGTTTGCTTTAGATGCTTTAAATGCAGGGGCAATCGCTATCTTGACAGACCTTTATAATCCTTTTCTACAAAAAATGGTCCAAGTGATTACTTCAGATGTGGAGAAGCTCAAACCGTTTTTAGCCAAGCGTTACTATGAAGCACCTTCTCAATCCCTTTTTGTTGTTGGGATTACAGGCACTAATGGAAAGACAACAACGGGATATCTGTTGCAGCATTTGCTTAGCTCAAAAACCCATCCTTGTGGTCTTATTGGAACCATTGAGTATTTAGTTGGCAATCAAAGATTGCCGGCTAAACTGACTACTCCAGATGTTGTTACTAATCATAAATTCTTACGTGAAATGCTTGATATGGGTGCCGAATCTGCTGTGATGGAAGTGTCCTCACATGCACTCGAACAAAATCGTGTGGTAGGGATCGACTTTGACGCTGCTATTTTTACAAACCTTTCTCAGGATCACCTTGACTATCACGGAACGATGGAACATTATTGCAAGGCAAAAGCAAAACTTTTTGCTTTGGTTGATGATCCGAGTAAAATCGCGATTGTTAACGGAGATGATCCTCAATATAAAAATATAATAGGTTCTTGTAAGGGGCAATTGATTACCTATGGAATCAAAAGCGATGCAGATGTACGTGCGAAAGGAATCGAGATGAGCTTAACGGGCTCGTGCTTTATAACCTGTTTTCAGGGAAAAACATTTTCTATTCAATCACCTCTTATTGGGCATTTTAATGTTTATAATCTACTTGCGGCCATTGCTCTTGCTTTAGTTAAAGGTTTGGGATTAGCGGAAATTCGAAGGAAAATGCAAACATTCAAGGGGATTCCGGGACGGTTGCAGCGCATCGATAATTCTAAGGGAGTGCATCTTTTTGTTGACTTTGCTCACACAGATCAAGCTCTTGAGAATGTTCTCAAAACGCTCAGTCAAATTAAGACGGGTAAACTGATTACTATATTTGGTTGTGGTGGCGATCGTGATCGTAATAAACGTTCCAAAATGGCTCATGCCGCCGAGAAATTTTCTGACTGGATGATTGTAACTTCAGATAATCCTCGCCAAGAAGATCCTGCTAAAATTGCAGAGGAGGTTGTTGCCGGATTTCAGAACGAAAAACCTTATCTGATCGAAGTTGATAGGCGCAAAGCAATCGAGCGAGGGGTTTGCATGGCACAAGGGGGAGATATTGTCTTGATTGCGGGACGTGGTCATGAACCTTTCCAAAAAGTTGGGGGACGACTTATTCCTTTTGATGACCGAGAAGTAGCCTTTGAGGTTGCGAATTCAGAGGACTCTAGAAATATTGAGATCACTAAACCCATTCGTGATTATGTCGAGGAGAAAATTGGAAAAGTCGAGAAACTATCAGGGCACATCATTGATGTGAATGTACGGCTCGATGTTCAAAAACTTAGTCATTTCGTCGATATTACTTTGAATTTCTCCCACTTTAAAGTGAAGGTTGGGGCTGTCACAGATAATATGTACTCGGCGATCGATAAAGCCTCTGAAAAACTGACCGCAAAGCTTAGAAAATGGAAAAGTCGAATTCAAGATCACCATGTAAAGGGTGTTTCTGTCACGGAAATTGAAGTAAATGTCCTTGAAAAAGCGCTGGAAGAGATCGAAGATCTCAATGAAGAAATCATTGATGCAAATAACCGCACTGTTGAACAGGAGTATGCTTTACCGAAAGTGATAAAAAAGAAAAAACGCCCTCTGAAAATCCTGACGCTTGAGGAAGCTGTTATGAAAATGGAGCTTTCCGGAGATCATTTTCTTATTTTTCGATCTGAAGAAGAACAAGCATTAAAAGTGATTTATCGCAGACTCGATGGCAGTTATGGCGTTATGTCTCCTGAATAAACAAATTTATGATGTGGTTCGAAAACAGTGGGTAGAAGCTAATCCCGAAGAAGTAGTTCGTCAAAAGCTTCTTCATTATATGATCGATAAACTGGGGTATTCACG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O67631	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase OS=Aquifex aeolicus (strain VF5) OX=224324 GN=murE PE=3 SV=1
A4IM04	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase OS=Geobacillus thermodenitrificans (strain NG80-2) OX=420246 GN=murE PE=3 SV=1
Q819Q0	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase OS=Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711) OX=226900 GN=murE PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0015600 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16321 all species →	Ribosom_S30AE_C	Sigma 54 modulation/S30EA ribosomal protein C terminus	Domain	Interproscan
PF02875 all species →	Mur_ligase_C	Mur ligase family, glutamate ligase domain	Domain	Interproscan
PF08245 all species →	Mur_ligase_M	Mur ligase middle domain	Domain	Interproscan
PF02482 all species →	Ribosomal_S30AE	Sigma 54 modulation protein / S30EA ribosomal protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003489 all species →	Family	Ribosome hibernation promoting factor/RaiA	Interproscan
IPR018109 all species →	Conserved_site	Folylpolyglutamate synthetase, conserved site	Interproscan
IPR032528 all species →	Domain	Sigma 54 modulation/S30EA ribosomal protein, C-terminal	Interproscan
IPR036567 all species →	Homologous_superfamily	Ribosome hibernation promotion factor-like	Interproscan
IPR034694 all species →	Family	Ribosome hibernation promoting factor, long/plastid	Interproscan
IPR004101 all species →	Domain	Mur ligase, C-terminal	Interproscan
IPR036565 all species →	Homologous_superfamily	Mur-like, catalytic domain superfamily	Interproscan
IPR038416 all species →	Homologous_superfamily	Sigma 54 modulation/S30EA ribosomal protein, C-terminal domain superfamily	Interproscan
IPR036615 all species →	Homologous_superfamily	Mur ligase, C-terminal domain superfamily	Interproscan
IPR005761 all species →	Family	UDP-N-acetylmuramoylalanyl-D-glutamate-2,6-diaminopimelate ligase	Interproscan
IPR013221 all species →	Domain	Mur ligase, central	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23135 all species →	MUR LIGASE FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0044238 all species →	Biological Process	primary metabolic process	Interproscan
GO:0004326 all species →	Molecular Function	tetrahydrofolylpolyglutamate synthase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0009396 all species →	Biological Process	folic acid-containing compound biosynthetic process	Interproscan
GO:0009058 all species →	Biological Process	biosynthetic process	Interproscan
GO:0016881 all species →	Molecular Function	acid-amino acid ligase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0008360 all species →	Biological Process	regulation of cell shape	Interproscan
GO:0051301 all species →	Biological Process	cell division	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01928	murE; UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase	EC:6.3.2.13	Peptidoglycan biosynthesis and degradation proteins	ko01011	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Morbakka virulenta tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Morbakka virulenta, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →