Gene detail

Detailed information of KXJ20343.1 in Exaiptasia diaphana

Genomic Location: LJWW01000114.1:258727...272122
NR annotation: KXJ20343.1, Spectrin alpha chain, non-erythrocytic 1 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ20343.1

ATGGCAAAGTGTAGTCCATTTCATTCCGCGCATAGATATATAGGTAAAAAACTGATTGAAGCAACACAACAGCAGCAATTCAACAGGGGAGCAGAGGAYATTGACTTATGGTTTAATGAAATTGAGAACCTACTTGCTACAGATGATACTGGGAAGGACCTGACTTCTGTGAAAAATCTTCAGAAGAAGCATGACATGATTGAAGCTGATGTTGTGACTCGTGTGGAGAAGATTGAAGCTGTCAATGCCCAAGCAGCATTTTTAGAAGCAGACCACTTTGATGCTCCTGCTATCAAGCAAAAGAAGGAAATCCTCAATGAAAGATACCAAAAACTACATGCTCCACTTCAAGCAAGAAARGTTCAGCTTAAGAATGCAGCCAGGTTGAAGCAGTTCTTACATGATGTAGAAGATGAGCAAGCCTGGATAAGAGAGAAAGAACCAATTGCATCATCAACAAACACTGGAAGAGACTTGTTTGGTGCTCAGAACCTGTCCAAGAAACATCAAGCTCTCATGACTGAAATTTCCGGACATGAACCACGTATTAAAGCTGTAGAGTCTAGTGGCCAAGAAATGCTCAACGAAGGACATTTTGCCTCTGACCAAATCAAGGACAAATTGGATGATCTTGACCAAAAATGGAATGACTTAAAGGACAAGGCCAACGTTCGCAAAGGACATCTTGATGACTCGCTTCAGTCTCACCAGTATTTGGCTGACTCAGTAACTCCTACAACTGACATCTCAGACAAGGAATGTGTAATGGCACTTTATGACTACGAGGAAAAGACAGCAAGAGAGGTCTCCATGAAGAAGGGAGACATTCTTACTCTACTGAATGCTAGCAACAAGGATTGGTGGAAAGTGGAGACTAACGACCGTCAAGGATTTGTCCCAGCTGCGTATGTTAAGAGAATTGACTCCCATAAGGCTTCACAAGAACTTCTCTCTAAAGCCCCTGAGATTGACTCAGTTGTGCAGCAACAACAGGCTCTTGACGACAAGTATGATGAACTGATGAGAAAAGGTGAAGAAAGAAAACAAAAACTTGAAGATTCAATCCATCGTTATACCTTACTCCGTGAGGCTCATGAACTTGAGTCATGGATCAATGACAAGGAGGCAATAGTCACCAGCGAAGAAGTCGGCAAAGACTACGAACATGTTGAAGCCATGCAGAAGAAGTTTGACGACTTCCAGAAAGATTTAACAGCAAATGAAGTACGCATTAAGGAACTGACTGTCTTGGCTGAGAGGCTCAAGGAGGAGCACTACACTGAGTATGAAATGATCCAGGAGATGATTGAGAAACTGACTCAGAAATGGAAAGATCTCAATCACATGGCTGAGCAGCGCAAGGATAATTTGGACAGTGCACAAGAGATTCAGAAATTCCACAGGGACGCTGATGACACCAAAGCCTGGATTTCTGAGAAAGACACAGCTCTCTCCTCATCTGACTATGGCAGGGATTTGGCTAGTGTACAGGCATTGCAACGTAAACACGATGTCCTAGAAAGAGACCTTGCTGCTCTTGAAGAAAAGGTCCGCCAACTGAACATTGAGGCTGCTCGTCTTACCTCAACTCATCCAAGCAAGTCTCATGATATCGAGTCCAAGAGATATGAACTAGAAGAAGCTTGGGCCAATCTGAAAGACCAGGCTGCAGCAAGAAAGGGAAAACTACTAGATTCATATGACTATCAGCGTTTCCTCAACGAATACAGGGATCTTATCTCATGGATCAATGGTATCAAACAGCTTGTCTCTTCTGATGAGCTCGCCAAGGATGTCGCTAGTGCCGAGGCTTTGATTGACAGRCATCAGGAATATCGTGCAGAGATTGATGCCCGTGATAGCACCTTCCAAGCCTATGATGAATTTGGAAGAGAATTGCTGGAGAAAGAGCATTACGCCAGCCCAGACATACAAGAAAAGCTTGAAAAACTAGCAGAAGAACGGGACGAGCTTGAAAGAGCCTGGTTGGCAAGAAAACAGAGACTTGATGAGTGCCTTGAACTCCAGCTGTTCAACCGATCAGCAGAGCAGCTGGAAGCCTGGATGGCAACAAGAGAAGAAATTATCGAAAAAGAAGAAGATACTGAAGGAGAAGGAGCTGAAGCCTTGATCAAGAAGCACGAAGACTTTACTCGAGCTCTAAAAATCCAAGAAGAGAAGGTTGCAAACCTGAAAGCAAATGCSGATAGGTTGATTGAAGCTAATCACTAYGATTCGCCAGCCATTGCTGAAAGGATATCTGCTGTTCTAGCAAGGTGGGCAACCCTCAAGCAAGCCCTTGTTGAGCGTCGATCTAAACTAGGAGAATCGAAGACAATCCAGCAGTTTAGCCGTGATGCCGAGGACATTGAAGCGTGGATAAGTGAGAAACTGCAGACGGTTCTGGACGAGTCCTACAAGGACCCAACTAATCTACAATCAAAGTTCCAGAAGCATCAGGCGTTTGAGGCAGAGATCGAAGCAAACAAGGAGAGAGTCCTGGAGACRACTAACCTGGGAGAAGGTTTGATCGAGCAAAAGAAATGTGCCGGAAGTGAAGAAATCGTTCGTGAACGAATCACTAAACTAGAGCAGTCCTGGGAACAGCTGGTCATCAAGTCCCAGAAAAAGACCCAACATCTCAARGAAGCCAACCAACAGCAGCAATTCAACAACAACATCAAAGACCTKGATTTCTGGYTAGGCGAGGTGGAGAATTCCTTGTCATCCGATGACTATGGTCGTGATCTRGCCAGCGTGCAGAACTTGATTAAAAAGCACCAGCTTGTCGAAGCAGACATCGCAGCGCACGAGGACCGMATMACTCAACTTGARGCCCAGACTCAACACTTCGCTGAAGAAGGTCATTTTGATGCTGACGCTTTGCAAGAGAAATCCCAAGGAATCACTGAGCGTTACGAGAAGGTTAAAGACATGGCCTCCAACAGAAAAGACAAACTCCAGGAATCTAATGATCTGCACCAGTTCTACCGCAATGTTGACGACGAGGAGTCCTGGATCAAGGAGAAGAAGTTGCTTACAAGCTCTGAGGACTACGGGAAAGATCTSAGTGGTGTAGAGAAYTTGAGAAAGAAGCATCTTCGTCTGGAAGCTGAGATCTCTAACCACAAACCCAGAGTGGTTGCTGTGATCGACTGCGGTGAAAAGTTTGTAGAAGAGGGACATAGCAATTCCGATGAGATCAAAGCACGTGTTGTCGGGCTGCAAGAAAAGTGGGACGAACTGGAATCACTCGCTAAAGAAAGGCAACACAAGCTAGACGATTCTCTGGCTTACCAACAATTCAGTGCTAACGTTGACGAAGAGGTTTCCTGGATCAACGAGAAGAATACCTTGGTTGGTAGTGATGATTAYGGCGACACGCTAGCCGCTGTGCAGGGACTGCTCAAAAAGCACGAAGCCTTTGAGACTGATCTTGAAGTGCAYAGAGAGCGGGTAGCGGACATCGAGAGCGCTGGYAACAAACTCATTGAAGATGGGAACCACCAATCAGAACTTATCGAACACAGGATATCYTCAACAAAGAACAAGCTTGCAGAGTTGGAGCGCATGGCRTCGTATCGCAAGACCAAATTGAATGACAACTCRGCATTCTTGCAGTTTAACTGGAAGGCTGATGTTGTGGAATCATGGATTGGCGACAAGGAAGGCATTGCCAATTCCGAAGACATTGGTCGCGACTTGTCATCTGTGCAGACTCTTATCACAAAGCAGGAGACCTTTGAAGCTGGTCTGAATGCATTTGAAAACGAAGGCATTGCACGTGTKACAGCTCTGAAGGACGAGTTGGTYAGGTCTCAGCATGAGCAATCACCTGCCATCATCAAGCGCCATGATGATCTTATCAAGAGGTGGCAAGAGCTATTGGATGCTTCCCTGGCTCGCAAGGAACGACTCATCCAGTCACAAGAGCAGTACAAGAAGGTCGAAGATCTGTTCCTTCTTTTCGCAAAGAAAGCTTCTGCTTTCAACAGCTGGTTTGAGAATGCTGAAGAGGATCTCACCGACCCTGTCCGCTGTAACTCTGTAGAGGAAATAAGCGCACTCCAAGAAGCGCATGCACAGTTCAGACTGACCCTTGACCAAGCCGAGGAGGACATGTACGCTTTGAGGAAACTGGACCGACAAATAAAGAGCTACAAAGTCCAAGTTAACCCGTACACATGGTTCACTATGGAAGCCCTCGAAGACACCTGGGATAATCTCCAGAAAATCATCGAGGAGCGCGAAGAGGATCTCCGCAARGAGGCACAGCGTCAAGAATACAACGACGGSCTGCGCCAAGAGTTTGCGCAACATGCTAACGCCTTCCATGCCTGGCTTACGGAAACTAGGGCGATCATGGTAGAAGGACAAGGCGACCTTGAAGACCAGTTAGCAGAAATCAAAAAGAAAGACGCCGAGATAGCTGACAGTAAAGCYGACTTGGAAGTCATTGAAGGTCTTGGCTTCCAAATGGAAGAAGCACTTATCCTTGATAACAGGTATACTGAGCATAGCACGGTGGGACTTGCTCAACAGTGGGACCAACTCGACCAACTTGCCATGCGTATGAAACACAATCTCGAGCAGCAGATCCAGGCTCGTAAGACTACAGGTGTGTCAGAGGAAAGTCTCAAAGAGTTCACCATCATGTTCAAGCACTTCGACAAAGACAAGACCGGATATCTGGAYTATCAGGAATTCAAGTCTTGYTTGCGTTCATTGGGTTACGACCTGCCTGTTGTCGAAGAAGGAGAATCGGATCCAGACGACGGTGTTGTCTCCATGGGYGAGTACATGGCTTTCATGATTAGCCGTGAGACAGAAAACGTTGGCTCCAGTCARGAGGTTGARAATGCCTTCATGGCACTAACTGAAGGAGGCAAGAAGAAATACGTCACTGAATCCGACCTCTATCAGTCTCTCACCAAGGAACAGGCCGAGTATTGCATCGAGAACATGCGTCCRTATGTTGACGAGAAAGGCCGTGAGATACCTGGTGCCTACGATTACAAGTCATTCTGTGGTAAACTCTTTACTAACTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q13813	Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens OX=9606 GN=SPTAN1 PE=1 SV=3
P16086	Spectrin alpha chain, non-erythrocytic 1 OS=Rattus norvegicus OX=10116 GN=Sptan1 PE=1 SV=2
P16546	Spectrin alpha chain, non-erythrocytic 1 OS=Mus musculus OX=10090 GN=Sptan1 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001340 (this species only) · gene tree & orthology
Ubiquitin family	UBD\|Other\|SH3 · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00036 all species →	EF-hand_1	EF hand	Domain	Interproscan
PF00018 all species →	SH3_1	SH3 domain	Domain	Interproscan
PF00435 all species →	Spectrin	Spectrin repeat	Domain	Interproscan
PF08726 all species →	EFhand_Ca_insen	Ca2+ insensitive EF hand	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR018247 all species →	Binding_site	EF-Hand 1, calcium-binding site	Interproscan
IPR018159 all species →	Repeat	Spectrin/alpha-actinin	Interproscan
IPR002017 all species →	Repeat	Spectrin repeat	Interproscan
IPR014837 all species →	Domain	EF-hand, Ca insensitive	Interproscan
IPR035825 all species →	Domain	Alpha Spectrin, SH3 domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11915 all species →	SPECTRIN/FILAMIN RELATED CYTOSKELETAL PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0030036 all species →	Biological Process	actin cytoskeleton organization	Interproscan
GO:0030054 all species →	Cellular Component	cell junction	Interproscan
GO:0030864 all species →	Cellular Component	cortical actin cytoskeleton	Interproscan
GO:0042995 all species →	Cellular Component	cell projection	Interproscan
GO:0051015 all species →	Molecular Function	actin filament binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06114	SPTAN; spectrin alpha, non-erythrocytic (fodrin)	-	Cytoskeleton proteins	ko04812	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ20343.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

72TPM > 0

2Conditions

385.2Max TPM

219.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	36	184.77	268.34
whole animal · symbiotic	36	36	254.91	385.24

Per sample · hover a bar for the full sample record

Show the sample table (72 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	268.34
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	262.98
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	262.58
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	262.03
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	260.00
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	255.16
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	253.68
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	249.94
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	249.84
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	247.57
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	246.95
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	242.56
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	213.98
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	204.71
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	198.20
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	194.27
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	191.71
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	187.01
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	181.75
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	179.75
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	178.15
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	177.32
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	177.31
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	159.35
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	150.10
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	142.00
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	140.88
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	138.90
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	137.77
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	133.42
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	91.72
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	85.14
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	84.01
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	83.29
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	81.70
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	77.72
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	385.24
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	384.30
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	380.38
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	379.72
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	374.89
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	373.24
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	275.90
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	268.42
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	267.77
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	264.03
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	263.26
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	259.69
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	259.43
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	259.15
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	258.94
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	258.79
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	257.30
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	254.09
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	247.25
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	234.10
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	218.90
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	218.19
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	216.10
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	214.14
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	213.93
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	213.35
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	208.14
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	205.31
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	205.08
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	199.75
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	199.16
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	196.35
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	193.76
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	192.38
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	191.16
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	185.09

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Proteomic evidence

Peptides from this gene's protein product were identified in 2 re-processed proteomic datasets at a false discovery rate of q ≤ 0.01 (Comet + Percolator).

9Unique peptides

165PSMs

3.0%Max coverage

0.0001Best q-value

2Datasets

Dataset	Species	Tissue / condition	Peptides	PSMs	Coverage	Best q
PXD055908	Exaiptasia diaphana	Whole anemone Heat stress (32℃) vs Control	8	162	3%	0.0000707064	peptides
R.YEPVGNIDGLFVNNVR.K q=0.0000707064 R.LVWIESPVLPR.R q=0.00013678 R.EETSTVEEDDSDNSTLTKK.I q=0.000192666 R.WAEELASADSLTYSHER.G q=0.000343899 R.NTVEPVLFESDVK.Y q=0.000343899 R.LAIESQNFAEK.L q=0.00105258 K.NVDHIFEFIPR.N q=0.00172585 K.VTQIWYEEAK.H q=0.00844067
PXD045585	Exaiptasia diaphana	Symbiont Breviolum minutum Symbiosis establishment	1	3	0.4%	0.00211379	peptides
R.NEPVDTGLLEEESIK.T q=0.00211379

Search parameters for this evidence: Comet 2026.01, precursor 10 ppm, fragment 0.5 Da, fixed C+57.021464, variable M+15.9949,n+42.010565, PSM-level q ≤ 0.01 against . Parameters differ between datasets; open a dataset for its full provenance. · all proteins for Exaiptasia diaphana

Co-expression network

Genes whose expression across the transcriptome samples of Exaiptasia diaphana tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	42	KXJ30221.1	0.974086807492417
Negatively correlated	43	KXJ12241.1	-0.915765992384613

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Exaiptasia diaphana, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

Peak calls overlapping this gene

Assay	Sample	Peaks	Region

No called peak overlaps this gene in 2 available assays. Either the gene is not near an accessible or marked region in those samples, or it is not represented in the peak caller’s annotation.

Browse the full epigenomic landscape of this species: ChIP-seq · ATAC-seq.

DNA methylation (bisulphite samples)

Sample	Methylation profile
whole_animal_aposymbiotic_1	open
whole_animal_aposymbiotic_2	open
whole_animal_aposymbiotic_3	open
whole_animal_aposymbiotic_4	open
whole_animal_aposymbiotic_5	open
whole_animal_aposymbiotic_6	open
whole_animal_aposymbiotic_7	open
whole_animal_aposymbiotic_8	open
whole_animal_aposymbiotic_9	open
whole_animal_symbiotic_1	open
whole_animal_symbiotic_10	open
whole_animal_symbiotic_11	open
whole_animal_symbiotic_12	open
whole_animal_symbiotic_13	open
whole_animal_symbiotic_14	open
whole_animal_symbiotic_2	open
whole_animal_symbiotic_3	open
whole_animal_symbiotic_4	open
whole_animal_symbiotic_5	open
whole_animal_symbiotic_6	open
whole_animal_symbiotic_7	open
whole_animal_symbiotic_8	open
whole_animal_symbiotic_9	open

The DNA Methylation page locates this gene by scanning the bisulphite table, which holds one row per cytosine. For the largest datasets that scan takes a while to return; it does not mean the link is broken.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →