Gene detail

Detailed information of KXJ26271.1 in Exaiptasia diaphana

Genomic Location: LJWW01000031.1:606772...634810
NR annotation: KXJ26271.1, Protein unc-13-like B [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ26271.1

ATGTCAATCTTATGTGTTGTCGTTAAGAAGGGGAGGATTGAATCAAATCAAGCAAAATACAATTCATATGTGAAGATATTGCTACAAAATGCGTCCCTTCAAACAGAGGTTGACAAAGGCATAGCTCCAGTCTGGGGACAGGAGTTTGTTTTTGAGACCAACAAACTAGACCAGAGTCTGGTCTTAGAACTATGGAACAAAGGGTTCTTCTCAGATTCCTTACTTGGATCTGCTGCCATACCTCTTATGCAAATACACCATTCTCAAGAGGAGGGAAGAGGAACATGGGTGACGCTAGACTTAAACAACCAACAAACTGGACATAAACTTCTTGTGGACACAAGATTTGAGCTGCCATCTGGTTTGTCAGAAGAAGATGCAAGACTTTTACAAGAGAAACTTGACATGTTTTATAACATAATGGACCAGGAAATGGAAATACTCCAACAACAAGCCAAAAATAAAATGGATATCGGAGAGCGTCTTCCTTTAAGCCCTGCATTAAGTGACGAGATTTGTCAAGACATTGCTGTTGAAACAGAAGGGTTACCTGACAATAGTGATATTTCGGGGCTGGGATTCTTGGACCAAGAGGACATACTTTTCCAGGTTCCAAATCGCGCAACCAGTGACCTTRACAATGAAGAAAAAGAGAAACCAAAAGTCATACTGAGAGAAAAATCTCATGGCAGAAGTAAAAATCGCGATTTCAGAGTGTATTCACCAAGTCGTGATACATCAGAYAATGAACCTACTAACAGTGTAGACTTTACSAACGATGAATACGCTGATTTCGAGATGTCTGAAAATCAACAACTAAAGCAGGAAATCCTCTACGAGACAAACGATGAGATTTTACAAGCAGAATGGGAAATGGTTCCTAGTGATCTCCCTGATGGTGAACAAGAAGAGGATGACGGACCACCGAAACTAGTAAGAAAATTCGCCAAGAAAAAGAAATCACCAAGTTGTCGCAAGGCCTCATGGAATGAGCGGAATGAGGATTTGTTAAGAAACTTTGACAGCGTCCCAGTCAAAATAAACCGACGAAAGAAGTCTTTGCCTTTTCACCATCAACGAATGGCTACAAAAAGAACTTTTCCTGCTCAACTCAACATGGCACAAAGAGCAAATCTTAACGACGAAGAGCTGAAACAACACGTCTATAAAAAAGCACTTCAGGCGCTGATTTATCCCATCTCAGAGTGCGGTGTTAAATGTCACGAGCGTTGTCAAGATTTGCTGAACGCGGATTGTTTACAACGTGCCGCTGAAAAGTCGGTGAAACATGGTACAAAAGACAAGACTGATACAATTATCATAGCAATGCAAAGACGAATGGAAGACAGAGAACGACTTAAACCTGAGATATTTGAACTGATAAGGGAAGTTTTTCATGTCGACCCAAAGAGTCACGCAGGATTTCTAAAAGCAGTAAAAAAGCARATATCCACAGGAACATCAAAATGGCTAGCAAAGATTGCTATCACAGTTGCCAGCGCTCAAGGACTTATAGCCAAGGATAAAACAGGCACAAGTGATCCATATGTTACAGTTCAAGTAGGAAAAACAAAGAAACGAACAAGTACAATTCCACGTGAACTCAATCCGGAATGGAATGAAACGTTCTACTTCGAATGTCATAACTCAACTGATCGTATTAARATTCGTGTCTGGGATGAAGATGATGATATCAAATCAAGAGTACGTTCAAAACTCATCAGAGAACCTGACGACTTCCTCGGTCAAACTATCATTGAAGTACGGACCCTTAGTGGTGAAATGGATGTCTGGTATAATCTGGAAAAGAGAACTGACCGATCAGCGGTATCTGGTGCWATCCGATTAAAGATCACTATTGAAATAGAAGGAGAAGAGAAAGTCGTACCCTATCATACACAGTATACTTGTTTACATGAGAACATCTTTCATTATCTTTGCCAAAGGCACGAAGGGCAATTCCCTGTTCCAAGCACGGCTGGGCGAGAAGAATCATGGAAGGTTTTTTTTCTAGACACGGCTTTGGAAGTAGTCAACGAGTTTGCTATGAGATATGGTATAGAAAGCATCTATCAGGCAATGACACATTTTTCGTGCCTGACTTCATGTTATATGCATCCAAACATACCAGCTTTAATAAGTAGTCTTCTGGCAAACATTAATGCATTTTTTTCGCACACCACTGCAAACTCTGCTACCTCTGCCACTCATCGATTTGCAGCCACGAACTTTGGGACAAATTTCCCGTCATCCAGCCCTGACAAGCTGACCGATTTGAAGTCATCAGTTGATCTTCTGACMAGCATAACATTCTTTAGGATGAAGGTGTTGGGTCTTCGACCAACAAGAACTGCAGAAATAGTAGCAGAATGTGTCAAAAATTGCATGAAAGCCACTTACGCCTTTTTGTTTGCAAACTGYGTTGATTTGTATGATCGAGAGCTTGCATCAGAACGTAGCGTTCCAGAAAGTCAAGAGTCACAATCTGGACCTAAAAACTTGGATTTTTGGCCAAAACTGATCTCGTTAATAGTGTCAGTGATWGAAGAAGACCGTGGGATTTACACACAAGTTTTAAATCAGTTTCCCACCGAATTGAATGTCAGCGAGTGCAGTGCACAGACGTTTTGGAATCTTTTTGCTCGTGATTTGCAGGACATGCTACAAGATCACAGTTTAAACCCAGAATGGACCAGTGCAGATTACATGAATCTTCAATTTAAGGTTAAATGGTTCTTCAAYGAGTACGTCTTGAGTACCCCAGAAAACCGAGGAAAAATACCAGAATACACAGGATGGTTTGAACCATTTGTGTCTCAGTGGCTGACAGAAAATGATGAAGCTTCCATGGACTTTATGATCGCYGCATTGGAACGAGACAGAAAAGATGGGTTTCTTGCCAGTTCACAGCATTCTCTGTATTCTAGTTCTGTGGTAGATATCTTCTCATTGCTAAATCAGTCCAAAACACGAAAACAGATGAGAACTGAAGCTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O14795	Protein unc-13 homolog B OS=Homo sapiens OX=9606 GN=UNC13B PE=1 SV=2
Q9Z1N9	Protein unc-13 homolog B OS=Mus musculus OX=10090 GN=Unc13b PE=1 SV=2
Q9UPW8	Protein unc-13 homolog A OS=Homo sapiens OX=9606 GN=UNC13A PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002183 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06292 all species →	MUN	MUN domain	Repeat	Interproscan
PF00168 all species →	C2	C2 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR010439 all species →	Domain	MUN domain	Interproscan
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR014770 all species →	Domain	Munc13 homology 1	Interproscan
IPR027080 all species →	Family	Protein Unc-13	Interproscan
IPR037302 all species →	Domain	Protein Unc-13, C2B domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10480 all species →	PROTEIN UNC-13 HOMOLOG	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005516 all species →	Molecular Function	calmodulin binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007268 all species →	Biological Process	chemical synaptic transmission	Interproscan
GO:0007528 all species →	Biological Process	neuromuscular junction development	Interproscan
GO:0016081 all species →	Biological Process	synaptic vesicle docking	Interproscan
GO:0016082 all species →	Biological Process	synaptic vesicle priming	Interproscan
GO:0016188 all species →	Biological Process	synaptic vesicle maturation	Interproscan
GO:0017075 all species →	Molecular Function	syntaxin-1 binding	Interproscan
GO:0019992 all species →	Molecular Function	diacylglycerol binding	Interproscan
GO:0030672 all species →	Cellular Component	synaptic vesicle membrane	Interproscan
GO:0031594 all species →	Cellular Component	neuromuscular junction	Interproscan
GO:0035249 all species →	Biological Process	synaptic transmission, glutamatergic	Interproscan
GO:0042734 all species →	Cellular Component	presynaptic membrane	Interproscan
GO:0043195 all species →	Cellular Component	terminal bouton	Interproscan
GO:0061789 all species →	Biological Process	dense core granule priming	Interproscan
GO:0098831 all species →	Cellular Component	presynaptic active zone cytoplasmic component	Interproscan
GO:0099525 all species →	Biological Process	presynaptic dense core vesicle exocytosis	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0005543 all species →	Molecular Function	phospholipid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for KXJ26271.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ26271.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

67TPM > 0

2Conditions

78.0Max TPM

43.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	34	42.42	70.16
whole animal · symbiotic	36	33	44.13	78.04

Per sample · hover a bar for the full sample record

Show the sample table (72 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	70.16
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	69.88
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	61.64
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	60.62
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	58.47
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	56.61
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	56.59
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	56.40
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	55.24
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	54.41
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	50.90
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	46.73
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	43.38
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	43.27
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	42.38
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	41.41
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	40.85
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	39.45
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	39.44
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	38.82
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	38.65
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	37.98
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	37.95
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	37.40
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	37.23
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	36.01
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	35.67
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	35.16
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	35.15
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	34.69
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	34.55
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	34.17
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	33.23
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	32.79
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	78.04
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	77.19
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	77.17
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	73.87
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	72.87
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	70.42
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	69.02
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	64.36
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	63.77
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	63.71
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	63.01
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	62.84
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	42.33
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	42.26
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	42.04
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	41.90
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	40.74
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	40.20
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	39.63
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	39.52
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	38.79
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	38.48
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	38.08
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	35.07
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	34.05
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	34.04
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	33.45
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	33.36
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	31.44
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.50
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.10
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	27.58
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.98
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Proteomic evidence

Peptides from this gene's protein product were identified in 1 re-processed proteomic dataset at a false discovery rate of q ≤ 0.01 (Comet + Percolator).

1Unique peptides

7PSMs

5.0%Max coverage

0.0001Best q-value

1Datasets

Dataset	Species	Tissue / condition	Peptides	PSMs	Coverage	Best q
PXD045585	Exaiptasia diaphana	Symbiont Breviolum minutum Symbiosis establishment	1	7	5%	0.000121477	peptides
K.VGLIPSNYVEEHTESVDNPLHEAAK.R q=0.000121477

Search parameters for this evidence: Comet 2026.01, precursor 10 ppm, fragment 0.5 Da, fixed C+57.021464, variable M+15.9949, PSM-level q ≤ 0.01 against . · all proteins for Exaiptasia diaphana

Co-expression network

Genes whose expression across the transcriptome samples of Exaiptasia diaphana tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	42	KXJ28669.1	0.938537901202936
Negatively correlated	12	KXJ08033.1	-0.850315203682727

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Exaiptasia diaphana, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

Peak calls overlapping this gene

Assay	Sample	Peaks	Region
ChIP-seq	H3K27ac_symbiont	2	Promoter (<=1kb) 2
	H3K9ac_symbiont	1	Promoter (<=1kb) 1
ATAC-seq	Mild_Stress_Aposym	2	Intron 2
	Mild_Stress_Sym	1	Intron 1
	Stress_Day21_Sym	2	Intron 2

Browse the full epigenomic landscape of this species: ChIP-seq · ATAC-seq.

DNA methylation (bisulphite samples)

Sample	Methylation profile
whole_animal_aposymbiotic_1	open
whole_animal_aposymbiotic_2	open
whole_animal_aposymbiotic_3	open
whole_animal_aposymbiotic_4	open
whole_animal_aposymbiotic_5	open
whole_animal_aposymbiotic_6	open
whole_animal_aposymbiotic_7	open
whole_animal_aposymbiotic_8	open
whole_animal_aposymbiotic_9	open
whole_animal_symbiotic_1	open
whole_animal_symbiotic_10	open
whole_animal_symbiotic_11	open
whole_animal_symbiotic_12	open
whole_animal_symbiotic_13	open
whole_animal_symbiotic_14	open
whole_animal_symbiotic_2	open
whole_animal_symbiotic_3	open
whole_animal_symbiotic_4	open
whole_animal_symbiotic_5	open
whole_animal_symbiotic_6	open
whole_animal_symbiotic_7	open
whole_animal_symbiotic_8	open
whole_animal_symbiotic_9	open

The DNA Methylation page locates this gene by scanning the bisulphite table, which holds one row per cytosine. For the largest datasets that scan takes a while to return; it does not mean the link is broken.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →